21 Ağustos 2013 Çarşamba
Time to talk about Islamophobia!
Rationally Speaking isimli bir blogdan aldığım yarı yarıya çevirebildiğim ve okumaya değer bulduğum bir yazı.
Time to talk about Islamophobia
by Massimo Pigliucci
There is almost no way I’m not going to get in trouble with this one, and my name isn’t even Carlos Danger! But I’ve been asked several times by readers to comment on accusations of “Islamophobia” aimed at prominent New Atheists (henceforth, NA) — particularly Sam Harris and Richard Dawkins — and it seems time to get down to work.
A few prelims, though. First, this isn’t my attempt at sitting, Q-like, in judgment of the whole shebang, rendering the final verdict on the matter. Yes, I will provide my (solicited, in this case) opinion, but that’s all it is, an opinion. Second, the reason I have not touched on this before is twofold: on the one hand, I’ve logged a substantial number of posts critical of several New Atheists, and there is only so much one can criticize the same people before getting annoying rather than constructive. On the other hand, for a while now I’ve been busier with matters of science, philosophy and epistemology than with political ones, as testified to by the significantly lower frequency of posts on political issues at RS. Third, this cannot and will not be acomprehensive examination either of Islamophobia as a concept or even just of what Dawkins, Harris, etc. have written about Islam. Instead, I will focus on what seem to be some of the most aggressive accusations to the NA in this regard, those made in two postsover at Salon, by Nathan Lean. I wanted to get an idea of what the criticism was based on, both in terms of evidence and in terms of arguments. In other words, lower your expectations a bit, and let’s see where we can get with some reasoned discourse.
The first article by Lean was published on 30 March 2013, and was sparked by a series of tweets posted by Dawkins. Lean doesn’t start out too well. He accuses NA’s of sharing an “unholier-than-thou worldview” and of having “built lucrative empires” with their works. Not only can this sort of generic accusation be easily aimed — which much more reason — at a number of writers on the religious side of things, but it is irrelevant. The better-than-thou attitude may be irritating, but most certainly not uncommon among writers and commentators (including Lean himself); as for making money out of one’s books, as an author myself I seriously don’t see the problem, as long as one does it out of honest toil, as opposed to say plagiarism.
Lean proceeds with the suggestion that the whole NA phenomenon is the result of the 9/11 attacks, and particularly of the (surprising, even astonishing, in my mind) revival of the religious American fervors that followed them. He’s probably right, though again the identification of the causes of a social phenomenon is no indictment of said phenomenon.
And here comes the first incriminating quote, according to Lean, uttered by Dawkins a few days after 9/11: “Those people [the terrorists] were not mindless and they were certainly not cowards ... On the contrary, they had sufficiently effective minds braced with an insane courage, and it would pay us mightily to understand where that courage came from. It came from religion. Religion is also, of course, the underlying source of the divisiveness in the Middle East, which motivated the use of this deadly weapon in the first place.” Well, I think Dawkins got it partially right here. I say partially because I think religion is better thought of as a symptom, as well as a reinforcer, of these kinds of events, more than anything like a root cause. Regardless, religious fanaticism certainly had a lot to do with 9/11, together of course with a number of other causes that ought to be more deeply troubling for Americans: their military presence in Arab countries, their interference with said countries internal policies (often, though not always, not in the best interest of the people of those countries), their manipulation of Middle Eastern dictators, and of course their abysmal and willful failure to broker a fair peace in Israel-Palestine.
Lean also chastises Hitchens for mocking Muslims with the very title of his book, God is Not Great (because Muslims recite “God is great” during their prayers). So what? Atheists have always mocked religion, and for darn good reasons. And the best refrain to mockery is counter-mockery, not indignation. The latter only makes the receiver of the mockery look even more silly than he did before. But of course a number of religious fundamentalists are not exactly known for their sense of humor. Indeed, humor and sarcasm have always been among the most terrifying enemies of every strict religion. (btw, for the rest of this post it should be assumed that when I say “religion” I mean the fundamentalist, intransigent variety of the Abrahamic flavor, not religions or religious people in general. Please keep this in mind, it’s an important distinction.)
Now it’s Harris’ turn. He is quoted from Letter to a Christian Nation: “The idea that Islam is a ‘peaceful religion hijacked by extremists’ is a fantasy, and is now a particularly dangerous fantasy for Muslims to indulge.” That’s where things get complicated. Taken at face value, Harris is spectacularly wrong: terrorist attacks by Muslims do represent a small fraction of what’s going on in the Islamic world. But it is true that by far the larger number of terrorist attacks in recent years has been carried out in the name of Islam (of course, it depends on what one means by terrorism: include government actions, like the US war in Iraq, and we are talking about a completely different ball game). I don’t think that’s because Islam is aninherently more violent religion than Judaism and Christianity. Jews and Christians, after all, have been responsible for their share of massacres, genocides and ethnic cleansing throughout history. It’s just that in this particular historical moment they are violently affecting through terrorism far fewer people in far fewer areas of the world. (The last few lines, of course, represent my interpretation of what is essentially an empirical question. I will be happy to be corrected if I got the facts wrong.)
And now we are back to Dawkins’ twitter “rant” about the Quran: “Haven’t read Koran so couldn’t quote chapter and verse like I can for Bible. But [I] often say Islam [is the] greatest force for evil today.” Well, that’s just shabby, Dick. First off, criticizing books that one hasn’t read (or at least hasn’t read serious secondary sources about those books) is simply unacceptable for a major public intellectual. Second, here we go again with “greatest” and “evil.” Once more, fundamentalist adherence to Islam (and of course by far not all Muslims are fundamentalists) is likely one of the causal factors in a number of acts of violence in recent history, but to talk about it as the cause of it is unbelievably naive. (See partial list of other causes above; to which we should of course add lack of education and health care, major variables related to the success of religious fundamentalism.)
Another “incriminating” tweet from Dawkins: “Islam is comforting? Tell that to a woman, dressed in a bin bag [trash bag], her testimony worth half a man’s and needing 4 male witnesses to prove rape.” Lean thinks this sort of reasoning is ludicrous, but I think he is just as much off the mark as Dawkins, only in the opposite direction. Yes, Dawkins doesn’t seem to understand that some Muslim women truly do find wearing a burka comforting, and even a sign of respect. But Lean seems to ignore that that’s not really a sign of respect: it is a blatant sign of male oppression, and said women have simply been indoctrinated, sometimes violently, into a particular worldview. I’ll call this particular skirmish a draw.
More evidence: “Dawkins’ quest to ‘liberate’ Muslim women and smack them with a big ol’ heaping dose of George W. Bush freedom caused him to go berserk over news that a University College of London debate, hosted by an Islamic group, offered a separate seating option for conservative, practicing Muslims.” To begin with, to accuse Dawkins (unlike, say, Hitchens) of endorsing W.’s foreign policy is highly disingenuous. Second, Lean goes on to point out that at a recent event (a concert by Israeli violinist Itzhak Perlman) at the newly minted Barclays Center in Brooklyn the organizers offered separate gender seatings (as an option) to cater to the local Orthodox Jewish population. So why pick on the Muslims? Islamophobia! Setting aside the fact that Dawkins probably didn’t know about the latter event, how on earth is this “see? they do it too!” reasoning compelling at all? Dawkins was criticizing a British institution, qua British intellectual. Someone else in New York ought to have done the same in the case of the Barclays Center event (yes, I know, I missed that boat, wasn’t paying enough attention). And notice that just because the separate gender seating was facultative it doesn’t make the whole idea right to begin with, contra what is implied by Lean. (And of course it is worse in countries where this sort of thing is in fact mandatory, legal, and almost universally enforced. None of those countries can be found in the Western hemisphere, and not by chance...)
Lean is on better ground where he mentions that Dawkins has apparently praised right-wing extremist Geert Wilders, a Dutch politician known for saying that he hates Islam and that the Quran should be banned in the Netherlands. Dawkins is also alleged to have praised the short film Fitna, produced by Wilders, which draws a strong parallel between the Nazis (oh no, the Nazis!) and Muslims. Bad move indeed, Professor Dawkins.
And back to Harris (I know, this is causing you a headache from swirling around too much, but I’m following Lean almost paragraph by paragraph). Lean disapprovingly quotes Harris (in The End Of Faith) as writing: “The Israelis have shown a degree of restraint in their use of violence that the Nazis never contemplated and that, more to the point, no Muslim society would contemplate today.” Well, that strikes me as just about right on Harris’ part. Then again, it’s lowering the bar for Israel a bit too much to un-ironically say that the Israeli military is not quite as bad as the Nazis, no?
Finally (as far as the first essay is concerned) Lean impugns the very motives of the NA: “That’s not rational or enlightening or ‘free thinking’ or even intelligent. That’s opportunism. If atheism writ large was a tough sell to skeptics, the ‘New Atheism,’ Muslim-bashing atheism, must be like selling Bibles to believers.” I hardly think this is fair. I have no reason (nor, I suspect, does Lean) to think that the only, or even major motive for Harris, Dawkins, Hitchens and others to write what they write is to make money. It seems to me that they really do believe what they are saying. Which of course doesn’t automatically mean that it is intelligent or particularly informative.
Now to Lean’s second article, published on 10 August 2013. This time the focus is squarely on Dawkins, and again the occasion is offered by a tweet: “All the world’s Muslims have fewer Nobel Prizes than Trinity College, Cambridge. They did great things in the Middle Ages, though.” Yeah, that’s vintage Dawkins all right. But factually he is, of course, correct. And while one may not appreciate the sarcasm, there seemed to me little to criticize here, especially in terms of Islamophobia (since the number of Christian and Jewish Nobel winners is pretty high, I think, making picking on Islam fair.)
So on what bases, other than an accusation of superfluous sarcasm, does Lean criticize Dawkins? He begins by saying “Yes, the truth is that Muslims have received fewer Nobel Prizes than the sophisticated academic specialists at Trinity. But who in the hell cares apart from people like Dawkins.” Well, I would hope that Muslims cared. Assuming for a moment that the number of awarded Nobels in, say, science is a rough reflection of actual contributions to science (it is), then a society or societies whose recognized contributions are disproportionately less than their share of the world’s population ought to be worried. Of course, not all is well in Dawkins’ quarters either. I’m sure he meant to suggest that it is, again, religion that is responsible for this; and I again maintain that religion is more likely a co-causal factor as well as a symptom of the state of things, not the root cause. Investment in scientific research, level of and access to education, and so on, are also very much at the top of the list of explanations.
Lean: “there’s a difference between problematizing a religion’s tenets and persecuting its adherents.” Here perhaps we are simply using different dictionaries, since I don’t see how sarcastic tweets in any way constitute “persecution.” Persecution, rather, is what a number of Islamic countries do to their own freethinking citizens. (Of course they are not alone: see, just for a case recently in the news, Russia’s crackdown on gays and lesbians.)
Lean goes on to bring up again the University College debate (he must not have that many examples of Dawkinsian bigotry after all), and then moves to point out that Dawkins uses far too broad a brush when he talks of “Muslims” or “Islam” indiscriminately. This is definitely true, as the target should be more narrowly defined (say, Islamic fundamentalism), and the NA’s haven’t exactly made their mark in the Subtlety and Nuances department.
And then Lean slides into politically correct innuendos like this: “Sure, the Nobel Prize is an honorable recognition like no other. But it’s not insignificant that in Dawkins’s haste to come up with something cheeky to say about Muslims, he would use an accolade created by a Swedish philanthropist and awarded by an all-white committee of Scandinavians as a measuring stick for Muslim contributions in the world.” No, sorry, no go. This is sloppy to a vertiginous degree. First off, Lean is committing the genetic fallacy, criticizing X because of the origin of X (in this case the Nobel prize because it was established by a white dude and is awarded by other white dudes). The Nobels in science are always pretty much on target, and it is to the shame of Muslim countries that their scientists don’t have proportional entries in that roster. Second, Lean proceeds by pointing out that six Muslims have been awarded the Nobel for peace, notoriously the most politicized and questionable of the awards. Indeed, in the previous paragraph Lean himself had pointed out that Obama had been preemptively given the peace prize, going on to authorize drone strikes and secret surveillance operations on his own people. Finally, Lean reaches the absolute lowest point of his article when he says: “Muslim Nobel Prizes to date: 10. Dawkins Nobel Prizes to date: zero. That too, is a ‘fact,’ Mr. Dawkins.” Yes, and that is an irrelevant and childish comment to make, especially for someone who’s been ranting all along — for months — about the responsibilities of public intellectuals, a group to which surely a journalist writing for Salon belongs, or would like to belong.
So where does all of this leave us? Hard to keep score, given the bizarreness of comments on both sides. I’m pretty sure Dawkins and other NA’s are in fact guilty of over-focusing on Islam. Then again, there are somewhat good reasons to do so provided by recent history, given that the Christian Crusades and Inquisition have been over for a while. Dawkins & co. are also overly sarcastic, certainly not subtle, and they do seem to use far too wide a brush to paint their nemeses. But it’s not like one reads writings such as Lean’s and finds shiny examples of restraint, subtle humor and focused targeting. The obvious casualty of all this is serious criticism, of both Muslims and New Atheists.
There is almost no way I’m not going to get in trouble with this one, and my name isn’t even Carlos Danger! But I’ve been asked several times by readers to comment on accusations of “Islamophobia” aimed at prominent New Atheists (henceforth, NA) — particularly Sam Harris and Richard Dawkins — and it seems time to get down to work.
A few prelims, though. First, this isn’t my attempt at sitting, Q-like, in judgment of the whole shebang, rendering the final verdict on the matter. Yes, I will provide my (solicited, in this case) opinion, but that’s all it is, an opinion. Second, the reason I have not touched on this before is twofold: on the one hand, I’ve logged a substantial number of posts critical of several New Atheists, and there is only so much one can criticize the same people before getting annoying rather than constructive. On the other hand, for a while now I’ve been busier with matters of science, philosophy and epistemology than with political ones, as testified to by the significantly lower frequency of posts on political issues at RS. Third, this cannot and will not be acomprehensive examination either of Islamophobia as a concept or even just of what Dawkins, Harris, etc. have written about Islam. Instead, I will focus on what seem to be some of the most aggressive accusations to the NA in this regard, those made in two postsover at Salon, by Nathan Lean. I wanted to get an idea of what the criticism was based on, both in terms of evidence and in terms of arguments. In other words, lower your expectations a bit, and let’s see where we can get with some reasoned discourse.
The first article by Lean was published on 30 March 2013, and was sparked by a series of tweets posted by Dawkins. Lean doesn’t start out too well. He accuses NA’s of sharing an “unholier-than-thou worldview” and of having “built lucrative empires” with their works. Not only can this sort of generic accusation be easily aimed — which much more reason — at a number of writers on the religious side of things, but it is irrelevant. The better-than-thou attitude may be irritating, but most certainly not uncommon among writers and commentators (including Lean himself); as for making money out of one’s books, as an author myself I seriously don’t see the problem, as long as one does it out of honest toil, as opposed to say plagiarism.
Lean proceeds with the suggestion that the whole NA phenomenon is the result of the 9/11 attacks, and particularly of the (surprising, even astonishing, in my mind) revival of the religious American fervors that followed them. He’s probably right, though again the identification of the causes of a social phenomenon is no indictment of said phenomenon.
And here comes the first incriminating quote, according to Lean, uttered by Dawkins a few days after 9/11: “Those people [the terrorists] were not mindless and they were certainly not cowards ... On the contrary, they had sufficiently effective minds braced with an insane courage, and it would pay us mightily to understand where that courage came from. It came from religion. Religion is also, of course, the underlying source of the divisiveness in the Middle East, which motivated the use of this deadly weapon in the first place.” Well, I think Dawkins got it partially right here. I say partially because I think religion is better thought of as a symptom, as well as a reinforcer, of these kinds of events, more than anything like a root cause. Regardless, religious fanaticism certainly had a lot to do with 9/11, together of course with a number of other causes that ought to be more deeply troubling for Americans: their military presence in Arab countries, their interference with said countries internal policies (often, though not always, not in the best interest of the people of those countries), their manipulation of Middle Eastern dictators, and of course their abysmal and willful failure to broker a fair peace in Israel-Palestine.
Lean also chastises Hitchens for mocking Muslims with the very title of his book, God is Not Great (because Muslims recite “God is great” during their prayers). So what? Atheists have always mocked religion, and for darn good reasons. And the best refrain to mockery is counter-mockery, not indignation. The latter only makes the receiver of the mockery look even more silly than he did before. But of course a number of religious fundamentalists are not exactly known for their sense of humor. Indeed, humor and sarcasm have always been among the most terrifying enemies of every strict religion. (btw, for the rest of this post it should be assumed that when I say “religion” I mean the fundamentalist, intransigent variety of the Abrahamic flavor, not religions or religious people in general. Please keep this in mind, it’s an important distinction.)
Now it’s Harris’ turn. He is quoted from Letter to a Christian Nation: “The idea that Islam is a ‘peaceful religion hijacked by extremists’ is a fantasy, and is now a particularly dangerous fantasy for Muslims to indulge.” That’s where things get complicated. Taken at face value, Harris is spectacularly wrong: terrorist attacks by Muslims do represent a small fraction of what’s going on in the Islamic world. But it is true that by far the larger number of terrorist attacks in recent years has been carried out in the name of Islam (of course, it depends on what one means by terrorism: include government actions, like the US war in Iraq, and we are talking about a completely different ball game). I don’t think that’s because Islam is aninherently more violent religion than Judaism and Christianity. Jews and Christians, after all, have been responsible for their share of massacres, genocides and ethnic cleansing throughout history. It’s just that in this particular historical moment they are violently affecting through terrorism far fewer people in far fewer areas of the world. (The last few lines, of course, represent my interpretation of what is essentially an empirical question. I will be happy to be corrected if I got the facts wrong.)
And now we are back to Dawkins’ twitter “rant” about the Quran: “Haven’t read Koran so couldn’t quote chapter and verse like I can for Bible. But [I] often say Islam [is the] greatest force for evil today.” Well, that’s just shabby, Dick. First off, criticizing books that one hasn’t read (or at least hasn’t read serious secondary sources about those books) is simply unacceptable for a major public intellectual. Second, here we go again with “greatest” and “evil.” Once more, fundamentalist adherence to Islam (and of course by far not all Muslims are fundamentalists) is likely one of the causal factors in a number of acts of violence in recent history, but to talk about it as the cause of it is unbelievably naive. (See partial list of other causes above; to which we should of course add lack of education and health care, major variables related to the success of religious fundamentalism.)
Another “incriminating” tweet from Dawkins: “Islam is comforting? Tell that to a woman, dressed in a bin bag [trash bag], her testimony worth half a man’s and needing 4 male witnesses to prove rape.” Lean thinks this sort of reasoning is ludicrous, but I think he is just as much off the mark as Dawkins, only in the opposite direction. Yes, Dawkins doesn’t seem to understand that some Muslim women truly do find wearing a burka comforting, and even a sign of respect. But Lean seems to ignore that that’s not really a sign of respect: it is a blatant sign of male oppression, and said women have simply been indoctrinated, sometimes violently, into a particular worldview. I’ll call this particular skirmish a draw.
More evidence: “Dawkins’ quest to ‘liberate’ Muslim women and smack them with a big ol’ heaping dose of George W. Bush freedom caused him to go berserk over news that a University College of London debate, hosted by an Islamic group, offered a separate seating option for conservative, practicing Muslims.” To begin with, to accuse Dawkins (unlike, say, Hitchens) of endorsing W.’s foreign policy is highly disingenuous. Second, Lean goes on to point out that at a recent event (a concert by Israeli violinist Itzhak Perlman) at the newly minted Barclays Center in Brooklyn the organizers offered separate gender seatings (as an option) to cater to the local Orthodox Jewish population. So why pick on the Muslims? Islamophobia! Setting aside the fact that Dawkins probably didn’t know about the latter event, how on earth is this “see? they do it too!” reasoning compelling at all? Dawkins was criticizing a British institution, qua British intellectual. Someone else in New York ought to have done the same in the case of the Barclays Center event (yes, I know, I missed that boat, wasn’t paying enough attention). And notice that just because the separate gender seating was facultative it doesn’t make the whole idea right to begin with, contra what is implied by Lean. (And of course it is worse in countries where this sort of thing is in fact mandatory, legal, and almost universally enforced. None of those countries can be found in the Western hemisphere, and not by chance...)
Lean is on better ground where he mentions that Dawkins has apparently praised right-wing extremist Geert Wilders, a Dutch politician known for saying that he hates Islam and that the Quran should be banned in the Netherlands. Dawkins is also alleged to have praised the short film Fitna, produced by Wilders, which draws a strong parallel between the Nazis (oh no, the Nazis!) and Muslims. Bad move indeed, Professor Dawkins.
And back to Harris (I know, this is causing you a headache from swirling around too much, but I’m following Lean almost paragraph by paragraph). Lean disapprovingly quotes Harris (in The End Of Faith) as writing: “The Israelis have shown a degree of restraint in their use of violence that the Nazis never contemplated and that, more to the point, no Muslim society would contemplate today.” Well, that strikes me as just about right on Harris’ part. Then again, it’s lowering the bar for Israel a bit too much to un-ironically say that the Israeli military is not quite as bad as the Nazis, no?
Finally (as far as the first essay is concerned) Lean impugns the very motives of the NA: “That’s not rational or enlightening or ‘free thinking’ or even intelligent. That’s opportunism. If atheism writ large was a tough sell to skeptics, the ‘New Atheism,’ Muslim-bashing atheism, must be like selling Bibles to believers.” I hardly think this is fair. I have no reason (nor, I suspect, does Lean) to think that the only, or even major motive for Harris, Dawkins, Hitchens and others to write what they write is to make money. It seems to me that they really do believe what they are saying. Which of course doesn’t automatically mean that it is intelligent or particularly informative.
Now to Lean’s second article, published on 10 August 2013. This time the focus is squarely on Dawkins, and again the occasion is offered by a tweet: “All the world’s Muslims have fewer Nobel Prizes than Trinity College, Cambridge. They did great things in the Middle Ages, though.” Yeah, that’s vintage Dawkins all right. But factually he is, of course, correct. And while one may not appreciate the sarcasm, there seemed to me little to criticize here, especially in terms of Islamophobia (since the number of Christian and Jewish Nobel winners is pretty high, I think, making picking on Islam fair.)
So on what bases, other than an accusation of superfluous sarcasm, does Lean criticize Dawkins? He begins by saying “Yes, the truth is that Muslims have received fewer Nobel Prizes than the sophisticated academic specialists at Trinity. But who in the hell cares apart from people like Dawkins.” Well, I would hope that Muslims cared. Assuming for a moment that the number of awarded Nobels in, say, science is a rough reflection of actual contributions to science (it is), then a society or societies whose recognized contributions are disproportionately less than their share of the world’s population ought to be worried. Of course, not all is well in Dawkins’ quarters either. I’m sure he meant to suggest that it is, again, religion that is responsible for this; and I again maintain that religion is more likely a co-causal factor as well as a symptom of the state of things, not the root cause. Investment in scientific research, level of and access to education, and so on, are also very much at the top of the list of explanations.
Lean: “there’s a difference between problematizing a religion’s tenets and persecuting its adherents.” Here perhaps we are simply using different dictionaries, since I don’t see how sarcastic tweets in any way constitute “persecution.” Persecution, rather, is what a number of Islamic countries do to their own freethinking citizens. (Of course they are not alone: see, just for a case recently in the news, Russia’s crackdown on gays and lesbians.)
Lean goes on to bring up again the University College debate (he must not have that many examples of Dawkinsian bigotry after all), and then moves to point out that Dawkins uses far too broad a brush when he talks of “Muslims” or “Islam” indiscriminately. This is definitely true, as the target should be more narrowly defined (say, Islamic fundamentalism), and the NA’s haven’t exactly made their mark in the Subtlety and Nuances department.
And then Lean slides into politically correct innuendos like this: “Sure, the Nobel Prize is an honorable recognition like no other. But it’s not insignificant that in Dawkins’s haste to come up with something cheeky to say about Muslims, he would use an accolade created by a Swedish philanthropist and awarded by an all-white committee of Scandinavians as a measuring stick for Muslim contributions in the world.” No, sorry, no go. This is sloppy to a vertiginous degree. First off, Lean is committing the genetic fallacy, criticizing X because of the origin of X (in this case the Nobel prize because it was established by a white dude and is awarded by other white dudes). The Nobels in science are always pretty much on target, and it is to the shame of Muslim countries that their scientists don’t have proportional entries in that roster. Second, Lean proceeds by pointing out that six Muslims have been awarded the Nobel for peace, notoriously the most politicized and questionable of the awards. Indeed, in the previous paragraph Lean himself had pointed out that Obama had been preemptively given the peace prize, going on to authorize drone strikes and secret surveillance operations on his own people. Finally, Lean reaches the absolute lowest point of his article when he says: “Muslim Nobel Prizes to date: 10. Dawkins Nobel Prizes to date: zero. That too, is a ‘fact,’ Mr. Dawkins.” Yes, and that is an irrelevant and childish comment to make, especially for someone who’s been ranting all along — for months — about the responsibilities of public intellectuals, a group to which surely a journalist writing for Salon belongs, or would like to belong.
So where does all of this leave us? Hard to keep score, given the bizarreness of comments on both sides. I’m pretty sure Dawkins and other NA’s are in fact guilty of over-focusing on Islam. Then again, there are somewhat good reasons to do so provided by recent history, given that the Christian Crusades and Inquisition have been over for a while. Dawkins & co. are also overly sarcastic, certainly not subtle, and they do seem to use far too wide a brush to paint their nemeses. But it’s not like one reads writings such as Lean’s and finds shiny examples of restraint, subtle humor and focused targeting. The obvious casualty of all this is serious criticism, of both Muslims and New Atheists.
3 Ağustos 2013 Cumartesi
Bu Ödevin Midemde Ağrılara Sebep Olduğu Günleri Hatırlıyorum
DESİGNİNG THE FUSİON PROTEİN :
1.
KLONLANACAK DNA DİZİSİ VE ÖZELLİKLERİNİN BELİRLENMESİ
- Klonlanacak diziyi içeren NCBI referans sekans kodu NM_002303 olan Homo sapiens leptin receptor (LEPR) (transcript variant 1, mRNA) geninin CDS (kodlayan sekans dizisi) dizisi çıkarılır. Protein kodlayan ilk 105 baz insert olarak kullanılacağı için başlangıç kodonu olan ilk ''atg'' diziliminden başlanarak 105 bazlık dizi işaretlenir (sarı renkli arka plan).
- Bu dizi ile birlikte kullanılması uygun restriksiyon enzimleri ve vektörler belirlenir.
ORIGIN
1 ccggtctggc ttgggcaggc tgcccgggcc gtggcaggaa gccggaagca gccgcggccc 61 cagttcggga gacatggcgg gcgttaaagc tctcgtggca ttatccttca gtggggctat 121 tggactgact tttcttatgc tgggatgtgc cttagaggat tatgggtgta cttctctgaa 181 gtaagatgat ttgtcaaaaa ttctgtgtgg ttttgttaca ttgggaattt atttatgtga 241 taactgcgtt taacttgtca tatccaatta ctccttggag atttaagttg tcttgcatgc 301 caccaaattc aacctatgac tacttccttt tgcctgctgg actctcaaag aatacttcaa 361 attcgaatgg acattatgag acagctgttg aacctaagtt taattcaagt ggtactcact 421 tttctaactt atccaaaaca actttccact gttgctttcg gagtgagcaa gatagaaact 481 gctccttatg tgcagacaac attgaaggaa agacatttgt ttcaacagta aattctttag 541 tttttcaaca aatagatgca aactggaaca tacagtgctg gctaaaagga gacttaaaat 601 tattcatctg ttatgtggag tcattattta agaatctatt caggaattat aactataagg 661 tccatctttt atatgttctg cctgaagtgt tagaagattc acctctggtt ccccaaaaag 721 gcagttttca gatggttcac tgcaattgca gtgttcatga atgttgtgaa tgtcttgtgc 781 ctgtgccaac agccaaactc aacgacactc tccttatgtg tttgaaaatc acatctggtg 841 gagtaatttt ccagtcacct ctaatgtcag ttcagcccat aaatatggtg aagcctgatc 901 caccattagg tttgcatatg gaaatcacag atgatggtaa tttaaagatt tcttggtcca 961 gcccaccatt ggtaccattt ccacttcaat atcaagtgaa atattcagag aattctacaa 1021 cagttatcag agaagctgac aagattgtct cagctacatc cctgctagta gacagtatac 1081 ttcctgggtc ttcgtatgag gttcaggtga ggggcaagag actggatggc ccaggaatct 1141 ggagtgactg gagtactcct cgtgtcttta ccacacaaga tgtcatatac tttccaccta 1201 aaattctgac aagtgttggg tctaatgttt cttttcactg catctataag aaggaaaaca 1261 agattgttcc ctcaaaagag attgtttggt ggatgaattt agctgagaaa attcctcaaa 1321 gccagtatga tgttgtgagt gatcatgtta gcaaagttac ttttttcaat ctgaatgaaa 1381 ccaaacctcg aggaaagttt acctatgatg cagtgtactg ctgcaatgaa catgaatgcc 1441 atcatcgcta tgctgaatta tatgtgattg atgtcaatat caatatctca tgtgaaactg 1501 atgggtactt aactaaaatg acttgcagat ggtcaaccag tacaatccag tcacttgcgg 1561 aaagcacttt gcaattgagg tatcatagga gcagccttta ctgttctgat attccatcta 1621 ttcatcccat atctgagccc aaagattgct atttgcagag tgatggtttt tatgaatgca 1681 ttttccagcc aatcttccta ttatctggct acacaatgtg gattaggatc aatcactctc 1741 taggttcact tgactctcca ccaacatgtg tccttcctga ttctgtggtg aagccactgc 1801 ctccatccag tgtgaaagca gaaattacta taaacattgg attattgaaa atatcttggg 1861 aaaagccagt ctttccagag aataaccttc aattccagat tcgctatggt ttaagtggaa 1921 aagaagtaca atggaagatg tatgaggttt atgatgcaaa atcaaaatct gtcagtctcc 1981 cagttccaga cttgtgtgca gtctatgctg ttcaggtgcg ctgtaagagg ctagatggac 2041 tgggatattg gagtaattgg agcaatccag cctacacagt tgtcatggat ataaaagttc 2101 ctatgagagg acctgaattt tggagaataa ttaatggaga tactatgaaa aaggagaaaa 2161 atgtcacttt actttggaag cccctgatga aaaatgactc attgtgcagt gttcagagat 2221 atgtgataaa ccatcatact tcctgcaatg gaacatggtc agaagatgtg ggaaatcaca 2281 cgaaattcac tttcctgtgg acagagcaag cacatactgt tacggttctg gccatcaatt 2341 caattggtgc ttctgttgca aattttaatt taaccttttc atggcctatg agcaaagtaa 2401 atatcgtgca gtcactcagt gcttatcctt taaacagcag ttgtgtgatt gtttcctgga 2461 tactatcacc cagtgattac aagctaatgt attttattat tgagtggaaa aatcttaatg 2521 aagatggtga aataaaatgg cttagaatct cttcatctgt taagaagtat tatatccatg 2581 atcattttat ccccattgag aagtaccagt tcagtcttta cccaatattt atggaaggag 2641 tgggaaaacc aaagataatt aatagtttca ctcaagatga tattgaaaaa caccagagtg 2701 atgcaggttt atatgtaatt gtgccagtaa ttatttcctc ttccatctta ttgcttggaa 2761 cattattaat atcacaccaa agaatgaaaa agctattttg ggaagatgtt ccgaacccca 2821 agaattgttc ctgggcacaa ggacttaatt ttcagaagcc agaaacgttt gagcatcttt 2881 ttatcaagca tacagcatca gtgacatgtg gtcctcttct tttggagcct gaaacaattt 2941 cagaagatat cagtgttgat acatcatgga aaaataaaga tgagatgatg ccaacaactg 3001 tggtctctct actttcaaca acagatcttg aaaagggttc tgtttgtatt agtgaccagt 3061 tcaacagtgt taacttctct gaggctgagg gtactgaggt aacctatgag gacgaaagcc 3121 agagacaacc ctttgttaaa tacgccacgc tgatcagcaa ctctaaacca agtgaaactg 3181 gtgaagaaca agggcttata aatagttcag tcaccaagtg cttctctagc aaaaattctc 3241 cgttgaagga ttctttctct aatagctcat gggagataga ggcccaggca ttttttatat 3301 tatcagatca gcatcccaac ataatttcac cacacctcac attctcagaa ggattggatg 3361 aacttttgaa attggaggga aatttccctg aagaaaataa tgataaaaag tctatctatt 3421 atttaggggt cacctcaatc aaaaagagag agagtggtgt gcttttgact gacaagtcaa 3481 gggtatcgtg cccattccca gccccctgtt tattcacgga catcagagtt ctccaggaca 3541 gttgctcaca ctttgtagaa aataatatca acttaggaac ttctagtaag aagacttttg 3601 catcttacat gcctcaattc caaacttgtt ctactcagac tcataagatc atggaaaaca 3661 agatgtgtga cctaactgtg taatttcact gaagaaacct tcagatttgt gttataatgg 3721 gtaatataaa gtgtaataga ttatagttgt gggtgggaga gagaaaagaa accagagtca 3781 aatttgaaaa taattgttcc aaatgaatgt tgtctgtttg ttctctctta gtaacataga 3841 caaaaaattt gagaaagcct tcataagcct accaatgtag acacgctctt ctattttatt 3901 cccaagctct agtgggaagg tcccttgttt ccagctagaa ataagcccaa cagacaccat 3961 cttttgtgag atgtaattgt tttttcagag ggcgtgttgt tttacctcaa gtttttgttt 4021 tgtaccaaca cacacacaca cacacattct taacacatgt ccttgtgtgt tttgagagta 4081 tattatgtat ttatattttg tgctatcaga ctgtaggatt tgaagtagga ctttcctaaa 4141 tgtttaagat aaacagaatt c >gi|310923184:186-3683 Homo sapiens leptin receptor (LEPR), transcript variant 1, mRNA ATGATTTGTCAAAAATTCTGTGTGGTTTTGTTACATTGGGAATTTATTTATGTGATAACTGCGTTTAACT TGTCATATCCAATTACTCCTTGGAGATTTAAGTTGTCTTGCATGCCACCAAATTCAACCTATGACTACTT CCTTTTGCCTGCTGGACTCTCAAAGAATACTTCAAATTCGAATGGACATTATGAGACAGCTGTTGAACCT AAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTATCCAAAACAACTTTCCACTGTTGCTTTCGGAGTG AGCAAGATAGAAACTGCTCCTTATGTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAATTC TTTAGTTTTTCAACAAATAGATGCAAACTGGAACATACAGTGCTGGCTAAAAGGAGACTTAAAATTATTC ATCTGTTATGTGGAGTCATTATTTAAGAATCTATTCAGGAATTATAACTATAAGGTCCATCTTTTATATG TTCTGCCTGAAGTGTTAGAAGATTCACCTCTGGTTCCCCAAAAAGGCAGTTTTCAGATGGTTCACTGCAA TTGCAGTGTTCATGAATGTTGTGAATGTCTTGTGCCTGTGCCAACAGCCAAACTCAACGACACTCTCCTT ATGTGTTTGAAAATCACATCTGGTGGAGTAATTTTCCAGTCACCTCTAATGTCAGTTCAGCCCATAAATA TGGTGAAGCCTGATCCACCATTAGGTTTGCATATGGAAATCACAGATGATGGTAATTTAAAGATTTCTTG GTCCAGCCCACCATTGGTACCATTTCCACTTCAATATCAAGTGAAATATTCAGAGAATTCTACAACAGTT ATCAGAGAAGCTGACAAGATTGTCTCAGCTACATCCCTGCTAGTAGACAGTATACTTCCTGGGTCTTCGT ATGAGGTTCAGGTGAGGGGCAAGAGACTGGATGGCCCAGGAATCTGGAGTGACTGGAGTACTCCTCGTGT CTTTACCACACAAGATGTCATATACTTTCCACCTAAAATTCTGACAAGTGTTGGGTCTAATGTTTCTTTT CACTGCATCTATAAGAAGGAAAACAAGATTGTTCCCTCAAAAGAGATTGTTTGGTGGATGAATTTAGCTG AGAAAATTCCTCAAAGCCAGTATGATGTTGTGAGTGATCATGTTAGCAAAGTTACTTTTTTCAATCTGAA TGAAACCAAACCTCGAGGAAAGTTTACCTATGATGCAGTGTACTGCTGCAATGAACATGAATGCCATCAT CGCTATGCTGAATTATATGTGATTGATGTCAATATCAATATCTCATGTGAAACTGATGGGTACTTAACTA AAATGACTTGCAGATGGTCAACCAGTACAATCCAGTCACTTGCGGAAAGCACTTTGCAATTGAGGTATCA TAGGAGCAGCCTTTACTGTTCTGATATTCCATCTATTCATCCCATATCTGAGCCCAAAGATTGCTATTTG CAGAGTGATGGTTTTTATGAATGCATTTTCCAGCCAATCTTCCTATTATCTGGCTACACAATGTGGATTA GGATCAATCACTCTCTAGGTTCACTTGACTCTCCACCAACATGTGTCCTTCCTGATTCTGTGGTGAAGCC ACTGCCTCCATCCAGTGTGAAAGCAGAAATTACTATAAACATTGGATTATTGAAAATATCTTGGGAAAAG CCAGTCTTTCCAGAGAATAACCTTCAATTCCAGATTCGCTATGGTTTAAGTGGAAAAGAAGTACAATGGA AGATGTATGAGGTTTATGATGCAAAATCAAAATCTGTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTCTA TGCTGTTCAGGTGCGCTGTAAGAGGCTAGATGGACTGGGATATTGGAGTAATTGGAGCAATCCAGCCTAC ACAGTTGTCATGGATATAAAAGTTCCTATGAGAGGACCTGAATTTTGGAGAATAATTAATGGAGATACTA TGAAAAAGGAGAAAAATGTCACTTTACTTTGGAAGCCCCTGATGAAAAATGACTCATTGTGCAGTGTTCA GAGATATGTGATAAACCATCATACTTCCTGCAATGGAACATGGTCAGAAGATGTGGGAAATCACACGAAA TTCACTTTCCTGTGGACAGAGCAAGCACATACTGTTACGGTTCTGGCCATCAATTCAATTGGTGCTTCTG TTGCAAATTTTAATTTAACCTTTTCATGGCCTATGAGCAAAGTAAATATCGTGCAGTCACTCAGTGCTTA TCCTTTAAACAGCAGTTGTGTGATTGTTTCCTGGATACTATCACCCAGTGATTACAAGCTAATGTATTTT ATTATTGAGTGGAAAAATCTTAATGAAGATGGTGAAATAAAATGGCTTAGAATCTCTTCATCTGTTAAGA AGTATTATATCCATGATCATTTTATCCCCATTGAGAAGTACCAGTTCAGTCTTTACCCAATATTTATGGA AGGAGTGGGAAAACCAAAGATAATTAATAGTTTCACTCAAGATGATATTGAAAAACACCAGAGTGATGCA GGTTTATATGTAATTGTGCCAGTAATTATTTCCTCTTCCATCTTATTGCTTGGAACATTATTAATATCAC ACCAAAGAATGAAAAAGCTATTTTGGGAAGATGTTCCGAACCCCAAGAATTGTTCCTGGGCACAAGGACT TAATTTTCAGAAGCCAGAAACGTTTGAGCATCTTTTTATCAAGCATACAGCATCAGTGACATGTGGTCCT CTTCTTTTGGAGCCTGAAACAATTTCAGAAGATATCAGTGTTGATACATCATGGAAAAATAAAGATGAGA TGATGCCAACAACTGTGGTCTCTCTACTTTCAACAACAGATCTTGAAAAGGGTTCTGTTTGTATTAGTGA CCAGTTCAACAGTGTTAACTTCTCTGAGGCTGAGGGTACTGAGGTAACCTATGAGGACGAAAGCCAGAGA CAACCCTTTGTTAAATACGCCACGCTGATCAGCAACTCTAAACCAAGTGAAACTGGTGAAGAACAAGGGC TTATAAATAGTTCAGTCACCAAGTGCTTCTCTAGCAAAAATTCTCCGTTGAAGGATTCTTTCTCTAATAG CTCATGGGAGATAGAGGCCCAGGCATTTTTTATATTATCAGATCAGCATCCCAACATAATTTCACCACAC CTCACATTCTCAGAAGGATTGGATGAACTTTTGAAATTGGAGGGAAATTTCCCTGAAGAAAATAATGATA AAAAGTCTATCTATTATTTAGGGGTCACCTCAATCAAAAAGAGAGAGAGTGGTGTGCTTTTGACTGACAA GTCAAGGGTATCGTGCCCATTCCCAGCCCCCTGTTTATTCACGGACATCAGAGTTCTCCAGGACAGTTGC TCACACTTTGTAGAAAATAATATCAACTTAGGAACTTCTAGTAAGAAGACTTTTGCATCTTACATGCCTC AATTCCAAACTTGTTCTACTCAGACTCATAAGATCATGGAAAACAAGATGTGTGACCTAACTGTGTAA
Şekil 1: LEPR gen haritasında gene ait ilk exon bölgesinin gösterimi.
Ökaryotik hücrelerde yapılacak klonlama için ökaryotik özellikte ve insert' ün vektör içerisine yerleştiğinin anlaşılması amacıyla da reporter gen içeren vektör seçilmelidir. Amacımız füzyon proteini oluşturmak olduğu için de vektöre insert edilecek dizi, reporter gen bölgesinin dizisini bozmayacak şekilde (in-frame biçimde) reporter genin önüne veya arkasına yerleştirilmelidir.İnsert reporter genin önüne yerleştirilecekse (kullanılacak olan ve şekil 2 de gösterilen pGL2-Control vektörüne göre öyle olması gerekiyor) mRNA nın sentezlenebilmesi yani translasyonun-ekspresyonun gerçekleşebilmesi için insert ün 5' ucunda, transkripsiyonu doğru yerden başlatacak başlangıç kodonu (ATG) ve kozak dizisi olmalıdır. İnsert içinde stop kodonu veya poly A sinyali bulunması da mRNA sentezi sırasında tam sentez gerçekleşmeden (dizi tamamlanmadan) sentezi bitireceği için insert içinde bunların bulunmuyor olmasına dikkat edilmelidir.
Şekil 2 : Yapışkan uçlu ve düz uçlu klonlama deneylerinde kullanılacak olan vektör.
- Füzyon protein oluşturulabilmesi ve reporter genin özelliğinden yararlanılabilmesi için restriksiyon enzimlerinin kullanılması ve/veya insert ün yerleştirilmesi aşamalarının herhangi birinde reporter genin bütünlüğün bozulmamasına dikkat edilmelidir.
- pGL2-Control vektörü ökaryotik özellikte bir vektördür ve reporter gen özelliği gösteren antibiyotik (Ampisilin) direnç geni ve luciferase geni bulundurmaktadır. Tasarlanan füzyon proteininde füzyon proteini oluşturulurken insert ve luciferase genlerinin birleşiminden bir füzyon oluşturulması amaçlanmaktadır. Bu nedenle Luc+ proteininin düzgün biçimde ifade edilebilmesi için çerçeve kayması olmadan insert luc+ gen dizisinin önüne konulmalıdır.
- Kullanılan enzimlerin eksprese edilecek diziyi kesmemesine dikkat edilmelidir.
Şekil 3 : pGL2-Control vektörünün gen dizilimi üzerinde gen bölgeleri ve restriksiyon enzimlerinin kesim bölgelerinin gösterimi. 105 bazlık klonlanacak dizi:
5'ATGAGACAGCTGTTGAACCTAAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTATCCAAAACAACTTTCCACTGT
TGCTTTCGGAGTGAGCAAGATAGAAACT
3'
Şekil
4 :
105 bazlık diziyi kesen enzimler ve dizi üzerindeki yerlerinin
haritası.
2. YAPIŞKAN UÇLU KLONLAMA
Şekil 4 te bulunan enzim haritasına ve vektöre bakılarak uygun, yapışkan uçlu ve restriksiyon enzimi seçilmelidir.Bu deney düzeneğinde oluşturulmak istenilen füzyon proteininin reporter gen önünde olması ve promotörden sonra ve polyA sinyali oluşturan gen bölgesinden önce olması amacıyla çoklu klonlama bölgesi yerine HindIII kesim bölgesi kullanılmıştır.İnsert ün gen bütünlüğünün korunması için klonlama için kullanılacak enzimin insert ü uç noktalarından başka bir yerden kesmiyor olması gerekmektedir. Eğer insert vektörden tekrar çıkarılıp kullanılmak isteniyorsa ya da kesilen plazmit parçalarının insert ün bütünlüğünü bozması engellenmek isteniyorsa kullanılacak resitriksiyon enziminin kesim bölgesinin vektör içerisinde olmamasına da dikkat edilmesi gerekmektedir. Buna göre;Homo sapiens Leptin reseptör (LEPR) geni üzerinden uygun primerler kullanılarak klonlanması istenilen gen bölgesi PCR ile çoğaltılır. Bu işlem sırasında hata payını en aza indirmek amacıyla Taq DNA Polimeraz yerine Pfu DNA Polimeraz enzimi kullanılmalıdır. Böylece mutant dizi oluşumu engellenmiş olur.Bu işlem sırasında kullanılan primerler HindIII kesim bölgesi oluşmasını sağlayacak şekilde mismatch ler yapılarak tasarlanmalıdır.HindIII enzimi ve kesim dizisi: A^AGCTT
Klonlanacak diziyi içeren gen bölgesi: (forward primer)
hindIII-
Kozak
dizisi
CCTTTTGCCTGCTGGACTCTCAAAGAATACTTCAAATtcGcaTGGACATTATGAGACAGCTGTTGAACCT AAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTATCCAAAACAACTTTCCACTGTTGCTTTCGGAGTG AGCAAGATAGAAACTGCTCcTcgaaTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAATTC
TTTAGTTTTTCAACAAATAGATGCAAACTGGAACATACAGTGCTGGCTAAAAGGAGACTTAAAATTATTC
(reverse primer) *Mavi arka planlı olanlar HindIII kesim bölgeleri olarak belirlenmiştir ve bu alanlar içinde büyük harfle gösterilenler ise primerlerle birlikte değiştirilmesi gereken bazlardır. Kozak dizisi: ATTATGAG Kullanılacak primerler 1. Farward primer (mutant) : 5' CTTCAAATAAGCTTGGAC 3' Tm: 56,8 ºC orjinal dizi: 5' CTTCAAATTCGAATGGAC
Şekil 5 : Farward primerin oligo analizi. 2. Reverse primer (mutant): 5' GTTGTCTGCATTCGAAG 3' Tm: 58.9ºC
Şekil 6 : reverse primer ve oligo analizi
- Frame shift olmaması için 3’lü kodonlar olması sağlanmalıdır. 5' ucu kesim noktasından kayma olmaz. 3' ucunda da kesim noktasından öncesi ile klonlanacak 105 bazlık dizi arasında üçlü katlar şeklinde bazlar bulunduğundan klonlanacak dizi çerçeve kayması olmadan klonlanabilir, in frame yerleştirilir.
- Modifiye primerler tasarlanan inserte PCR uygulanır. PCR sırasında non-spesifik çoğalmış diziler olabilir, kontrol etmek ve saflaştırmak amaçlı olarak agaroz jelde yürütme işlemi uygulanır.
PCR
amplifikasyonu için ;
-negatif
kontrol
-Pfu
DNA Polimeraz
-Buffer
-dNTP
karışımı
-1,5
mM Mg++
-Forward
ve Reverse primerler
-Genomik
DNA
-Distile
su kullanılır.
- Hind III enzimiyle kesim plazmitin 239. bazından gerçekleştirilir. Bu kesim sonrasında tüp içerisine şekil 7 de gösterilen protokole uygun olarak CIP enzimi de eklenir.
- Kesim sonrası saflaştırma için tekrar alkol presipitasyonu yapılır. Plazmitin kesilip kesilmediği ve/veya tekrar birleşmelerin gerçekleşip gerçekleşmediğinin anlaşılabilmesi için agaroz jelde yürütme işlemi yapılır ve kesilen plazmitin lineer yapısından dolayı yavaş yürüyeceği blindiğinden bu özellik kullanılarak bir kontrol yapılır.
- Vektör aynı restriksiyon enzimiyle kesildiğinden 5’ ve 3’ uçların kendi üzerine yapışma ihtimali vardır. Bunu engellemek için vektörün 5’ ucu CIP’lenir. Plazmit Restriksiyon enzimi ile kesildikten sonra oluşan yapışkan uçlar plazmitin iki ucunun birbirine yapışmasına yol açabilir. Plazmit kesildikten sonra tekrar yapışmasını engellemek için 5’ uçlarındaki fosfat kökleri CIP (calf intestine phosphatase) enzimi kullanılarak çıkarılabilir.
- Yapılan CIP uygulaması sayesinde 5' uçtaki fosfatlar kesileceğinden aynı enzimle iki ucu kesilen dizide ligaz enziminin 5’ ve 3’ uçların birleştirmesini sağlayacak fosfat grubu bulunmaz ve vektör kendi içinde tekrar birleşmez.Şekil 7 : CIP uygulama protokolü
- Vektörün doğru yerden kesilip kesilmediğini anlamak için agaroz jelde yürütme yapılır ve doğru kesilen vektör izole edilip kullanılır.
- Kesilen vektör ve insert aynı tüpe eklenir ve T4 DNA Ligaz enzimi ile ligasyon yapılır (T4 kinaz enzimiyle, 160C de gece boyu).
- Ligasyon agaroz jel elektroforezi ile kontrol edilir. İnsert ve vektör ürünlerinin agaroz jelden izolasyonu sağlanır.Şekil 8 : T4 DNA ligaz kullanım protokolü
- Dizi analizi yapılırak kontrol edilir.Vektörün insert içerip içermediğine bakılır.
- CaCI yöntemiyle kompetan hücreler hazırlanır. Transformasyon gerçekleştirilir. Bu işlemlerde uygulanması gereken protokol aşağıdaki gibidir.Kompetant Hücre Hazırlanması
1.
37°C’de gece boyu büyütülmüş kültürden tek koloni seçilir.
2.
1L’lik erlenmeyer şişesinin içine 100ml LB besiyeri aktarılır.
3.
37°C’de 3 saat çalkalayıcı inkübatörde hücreler büyütülür.
4.
Kültürün büyümesi her 20 dakikada bir 600nm’de absorbansı
ölçülerek kontrol edilir.
5.
Hücreler, steril ve soğuk propilen tüplere aktarılır ve 10
dakika boyunca buzda bekletilir.
6.
4000rpm’de, 10 dakika boyunca 4°C sıcaklıkta santrifüjlenir.
Süpernatant dökülür.
7.
Her pelet, 2ml buz soğukluğunda 0.1M CaCl2 içinde çözülür ve
bir tüpte toplanır. Buz
içinde
bekletilir.
8.
4000rpm’de, 10 dakika boyunca 4°C sıcaklıkta santrifüjlenir.
Süpernatant dökülür.
9.
Peletler, 10ml’lik her kültür için 1,2ml olacak şekilde buz
soğukluğunda 0.1M CaCl2 +
%15
gliserolde çözülür.
10.
Elde edilen bakteri süspansiyonu 100µl lik alikotlar halinde
eppendorf tüplere aktarılır.
11.
Bu tüpler -80°C’lik dondurucuda saklanır.
Transformasyon
1.
Daha önceden CaCl2 yöntemiyle kompetan hale getirilmiş ve -80°C’de
saklanan 100µL bakteri stoğu 10 dakika buzda bekletilir.
2.
10 dakika sonunda buzda erimiş olan kompetan bakterilerin üzerine
1ng plasmid DNA’sı eklenir ve 30 dakika daha buzda bekletilir.
3.
Bakteriler buzdan alınıp 90 saniye boyunca sıcaklığı 42°C’de
sabitlenmiş ısı bloğunda ya da su banyosunda inkübe edilir.
4.
42°C’den alınan bakteriler 5 dakika buzda bekletilir.
5.
Daha sonra bakterilerin üzerine 900µL önceden 37°C’de inkübe
edilmiş LB (ya da SOC) sıvı besiyeri eklenir ve nazikçe pipetleme
yapılarak bakterilerin sıvı besiyerinde
dağılmaları
sağlanır.
6.
Hücreler 37°C’de 1 saat inkübe edilir.
7.
İnkübatörden alınan hücreler 14000 rpm’de 1 dakika
santrifüjlenerek çöktürülür. 8. Çökmüş hücrelerin
üzerinden 900µL süpernatant mikropipetle çekilip atılır. Pelet
olarak
çökmüş
hücreler, tüpün içinde kalan 100µL besiyerinde resüspanse
edilir.
9.
Bakteriler, plazmidin dirençlilik genini taşıdığı antibiyotiği
içeren LB agar plaklara ekilir ve 37°C’de gece boyu inkübe
edilir.
10.Bir
sonraki gün, transforme olmuş bakteri hücreleri plazmiddeki
antibiyotiğe dirençlilik genini taşıdıkları için
antibiyotikli agar plakta koloni oluşturabileceklerdir. Dolayısıyla
agarda büyümüş koloniler başarıyla trasforme edilebilen
bakterilerdir.
DÜZ
UÇLU KLONLAMA:
CCTTTTGCCTGCTGGACTCTCAAAGAATACTTCAAATTCGAATGGACATTATGAGACAGCTGTTGAACCT AAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTATCCAAAACAACTTTCCACTGTTGCTTTCGGAGTG AGCAAGATAGAAACTGCTCCTTATGTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAATTC Mutant dizi: SacI CCTTTTGCCTGCTGGACTCTCAAAGAATACTTCGAGCT/CGAATGGACATTATGAGACAGCTGTTGAACCT AAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTATCCAAAACAACTTTCCACTGTTGCTTTCGGAGTG AGCAAGATAGAAACTGCTCCTTATGAGCTCACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAATTC SacI
Kullanılan
enzim ve kesim bölgesi
sacI:
5' GAGCT/C 3'
3'
G/AGCTC 5'
Forward
Primer: 5' AGA ATA CTT CGA GCT/ CGA 3'
Tm:
60,6ºC
Şekil 9 : Küt uçlu klonlama için hazırlanan forward
primer.
Reverse
Primer: 5' GTTGTGAGCTCATAAGGAG 3' Tm:
60,4ºC
Şekil 10 : Küt uçlu klonlama için hazırlanan reverse primer.
İnsan
genom DNA sına ait leptin geninin klonlama gözlenecek ilk mRNA
bölgesinin klonlanması aşamasında iki türlü klonlama prosesi
için gerekli bilgiler yukarıda verilmiştir. Yapışkan uçlu için
gerekli prosesler küt uçlu için de geçerlidir. Fakat küt uçlu
klonlama yapılırken CIP enzimine gerek yoktur. Çünkü küt uçlu
klonlama da kesilen plazmit uçları tekrar birbiri üzerine yapışıp
sirküler hale gelmezler. Bunun dışında bütün ligasyon,
elektroforez ve PCR protokolleri benzerdir.
Oluşan
füzyon proteinleri iki türlü klonlama içinde luc geni önüne
konulmuştur. Bu durum petrilerde lusüferaz aktivitesi gile birlikte
transformasyonu yapılan dizininde aktivitesinin olduğunu gösterir.
Kaydol:
Kayıtlar (Atom)











